pgpH [2020-04-01 14:44:10]

c-di-AMP specific phosphodiesterase

Locus: BSU_25330

Isoelectric point: 7.70

Molecular weight: 78.98 kDa

Protein length: 711 aa

Gene length: 2136 bp

Function: control of c-di-AMP homeostasis

Product: c-di-AMP specific phosphodiesterase

Essential: no

Synonyms: yqfF

Genomic Context

Loading

Categories containing this gene/protein

• Metabolism → Nucleotide metabolism → Metabolism of signalling nucleotides
• Information processing → Targets of second messengers → Targets of (p)ppGpp
• Groups of genes → Membrane proteins

Gene

Coordinates: 2,612,282 2,614,417

Phenotypes of a mutant

• a gdpP pgpH double mutant acquires suppressor mutations in cdaA PubMed
• a gdpP pgpH double mutant is defective in biofilm formation PubMed
• altered morphology on MSgg medium PubMed
• suppresses the growth defect of glmR mutants on gluconeogenic substrates PubMed

The protein

Catalyzed reaction/ biological activity

• hydrolysis of c-di-AMP to 5'-pApA PubMed
• 3',3'-c-di-AMP + H₂O --> 5'-O-phosphonoadenylyl-(3'→5')-adenosine + H⁺ (according to UniProt)

Protein family

• PgpH phosphodiesterase family (single member, according to UniProt)

Domains

• HD domain (aa 501-643) (according to UniProt)

Cofactors

• Mn²⁺ PubMed

Effectors of protein activity

• ppGpp acts as allosteric inhibitor of phosphodiesterase activity (in Listeria monocytogenes) PubMed

Structure

• 4S1B (the HD domain of the protein from Listeria monocytogenes in complex with c-di-AMP, 58% identity, 85% similarity) PubMed

Localization

• cell membrane PubMed

Biological materials

Mutant

• MGNA-C432 (yqfF::erm), available at the NBRP B. subtilis, Japan
• SM-GN1 (pgpH-spc), available in Anne Galinier's and Boris Görke's labs PubMed
• BKE25330 (pgpH::erm without terminator, available in the BGSC and in Jörg Stülke's lab) PubMed
• GP2033 (pgpH::tet, available in Jörg Stülke's lab)
• GP2034 (pgpH::erm without terminator, available in Jörg Stülke's lab) PubMed
• GP2040 (gdpP::spc pgpH::erm without terminator, available in Jörg Stülke's lab) PubMed
• GP2049 (pgpH::cat without terminator, available in Jörg Stülke's lab)
• BKE25330 (pgpH::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CACAAGAACCTCCTCTTGAA, downstream forward: _UP4_GAGGCTACTAAGAAGGTGAA
• BKK25330 (pgpH::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CACAAGAACCTCCTCTTGAA, downstream forward: _UP4_GAGGCTACTAAGAAGGTGAA

LacZ fusion

• pGP190 (in pAC7), available in Jörg Stülke's lab

References

Reviews

Loading

Original publications

Loading